как получить кнопку pygame, чтобы зарегистрировать только один клик?

Я делаю игру в pygame с нажатой кнопкой, но я хочу, чтобы она делала только одно, когда щелкнула. Приведенный ниже код печатает кнопку «нажата» до тех пор, пока вы ее удерживаете. Каков элегантный способ изменить этот код, чтобы он печатал только один раз за клик? import pygame import sys pygame.init() screen = pygame.display.set_mode((640, 480),0,32) clock […]

Python – Прокручивающееся окно Оценка регрессии OLS

Для моей оценки у меня есть набор данных, найденный в этой ссылке ( https://drive.google.com/drive/folders/0B2Iv8dfU4fTUMVFyYTEtWXlzYkk ), как в следующем формате. Третий столбец (Y) в моем наборе данных – это моя истинная ценность – вот что я хотел предсказать (оценка). time XY 0.000543 0 10 0.000575 0 10 0.041324 1 10 0.041331 2 10 0.041336 3 10 […]

Повторное совпадение совпадений

Я пытаюсь создать следующее регулярное выражение: верните строку между AUG и ( UAG или UGA или UAA ) из следующей строки РНК: AGCCAUGUAGCUAACUCAGGUUACAUGGGGAUGACCCCGCGACUUGGAUUAGAGUCUCUUUUGGAAUAAGCCUGAAUGAUCCGAGUAGCAUCUCAG , так что будут найдены все совпадения, включая перекрывающиеся. Я пробовал несколько регулярных выражений, в итоге чего-то вроде этого: matches = re.findall('(?=AUG)(\w+)(?=UAG|UGA|UAA)',"AGCCAUGUAGCUAACUCAGGUUACAUGGGGAUGACCCCGCGACUUGGAUUAGAGUCUCUUUUGGAAUAAGCCUGAAUGAUCCGAGUAGCAUCUCAG") Не могли бы вы показать мне ошибки в моем шаблоне […]

Преобразование csv-файла в словарь

Я задал этот вопрос вчера, но я все еще застрял на нем. Я написал функцию, которая в настоящее время правильно читает файл, но есть несколько проблем. Основная проблема, с которой я сталкиваюсь, заключается в том, что мне нужно как-то пропустить первую строку файла, и я не уверен, верну я его в качестве словаря. Ниже приведен […]

Отправка gmail с ошибкой python

Ошибка 1. pip я сделал pip install smtplib Затем говорится: Could not find a version that satisfies the requirement smtplib (from versions: ) No matching distribution found for smtplib Я подтвердил, что pip install youtube_dl работает. Так что, наверное, это не проблема с pip. 2. Ошибка импорта В любом случае, код, который я запускаю, import […]

Вернуть загружаемую и отображаемую страницу в один флажок

Я хочу вернуть отображаемую страницу и загружаемый файл в ответ на запрос. Я попытался вернуть кортеж обоих ответов, но он не работает. Как я могу обслуживать загрузку и страницу? return response, render_template('database.html') return render_template('database.html'), response Может ли Flask обрабатывать такой сценарий? Похоже на обычную проблему, я просто хочу отправить файл обратно для загрузки, а затем […]

Запись данных в формате unicode в csv

Я знаю, что подобный вопрос задавался много раз, но серьезно я не смог правильно реализовать csv-writer, который правильно пишет в csv (он показывает мусор). Я пытаюсь использовать UnicodeWriter как упоминание в официальных документах . ff = open('a.csv', 'w') writer = UnicodeWriter(ff) st = unicode('Displaygrößen', 'utf-8') #gives (u'Displaygr\xf6\xdfen', 'utf-8') writer.writerow([st]) Это не дает мне никакой ошибки […]

pandas left join – почему больше результатов?

Как возможно, что панды df.merge(df2, left_on='first', right_on='second', how='left') увеличивает кадр данных с 221309 до 1388680 строк? редактировать форма df 1 (221309, 83) форма df2 (7602, 6)

psycopg2 как обращаться с TypeError: не все аргументы, преобразованные во время форматирования строки

У меня простой запрос к базе данных psycopg2, но я не знаю, почему он всегда показывает ошибки, вот код ip ="127.0.0.1" sql="select count(*) from radacct where nasipaddress=%s" cur.execute(sql,ip) то он покажет TypeError: не все аргументы, преобразованные во время форматирования строки и если я попытаюсь таким образом cur.execute("select count(*) from radacct where nasipaddress=%s" % ip) он […]

Выполнение одиночного unittest над последовательностью в python

У меня есть unittest, который может работать над некоторой последовательностью, где я проверяю результаты некоторой обработки над последовательностью. Мне все равно, есть ли индивидуальные сбои – пока я могу определить, на каком элементе последовательности обработка не принесла хорошего результата. Итак, вместо написания class MyTectClass(unittest.TestCase): ….. def TestOverSequence(self): for elem in sequence: <run a bunch of […]

Python - лучший язык программирования в мире.